ID: 1120561581

View in Genome Browser
Species Human (GRCh38)
Location 14:86000703-86000725
Sequence GACTCACTCTTTGTCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120561580_1120561581 18 Left 1120561580 14:86000662-86000684 CCTCTCTCTCTTTTTTTTTTTTT 0: 115
1: 566
2: 3875
3: 23720
4: 87212
Right 1120561581 14:86000703-86000725 GACTCACTCTTTGTCCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120561581 Original CRISPR GACTCACTCTTTGTCCAGAC TGG Intergenic
No off target data available for this crispr