ID: 1120563183

View in Genome Browser
Species Human (GRCh38)
Location 14:86021884-86021906
Sequence TTAATTCAGAAAATATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120563183_1120563184 25 Left 1120563183 14:86021884-86021906 CCAATAAATATTTTCTGAATTAA No data
Right 1120563184 14:86021932-86021954 GAAAGTCATATCCCAGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120563183 Original CRISPR TTAATTCAGAAAATATTTAT TGG (reversed) Intergenic
No off target data available for this crispr