ID: 1120564318

View in Genome Browser
Species Human (GRCh38)
Location 14:86036101-86036123
Sequence TGTTCCTAACAGCTGGGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120564314_1120564318 -9 Left 1120564314 14:86036087-86036109 CCGCTAGGGTGTGCTGTTCCTAA No data
Right 1120564318 14:86036101-86036123 TGTTCCTAACAGCTGGGGTATGG No data
1120564311_1120564318 14 Left 1120564311 14:86036064-86036086 CCAGGGATCAATGCAGCTATAAG No data
Right 1120564318 14:86036101-86036123 TGTTCCTAACAGCTGGGGTATGG No data
1120564308_1120564318 26 Left 1120564308 14:86036052-86036074 CCAAGGCCAATCCCAGGGATCAA No data
Right 1120564318 14:86036101-86036123 TGTTCCTAACAGCTGGGGTATGG No data
1120564309_1120564318 20 Left 1120564309 14:86036058-86036080 CCAATCCCAGGGATCAATGCAGC No data
Right 1120564318 14:86036101-86036123 TGTTCCTAACAGCTGGGGTATGG No data
1120564310_1120564318 15 Left 1120564310 14:86036063-86036085 CCCAGGGATCAATGCAGCTATAA No data
Right 1120564318 14:86036101-86036123 TGTTCCTAACAGCTGGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120564318 Original CRISPR TGTTCCTAACAGCTGGGGTA TGG Intergenic
No off target data available for this crispr