ID: 1120567842

View in Genome Browser
Species Human (GRCh38)
Location 14:86081505-86081527
Sequence TTGGTACTAAAGGCATTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120567840_1120567842 -7 Left 1120567840 14:86081489-86081511 CCTGTGACAAAGTTCATTGGTAC No data
Right 1120567842 14:86081505-86081527 TTGGTACTAAAGGCATTAGAAGG No data
1120567838_1120567842 4 Left 1120567838 14:86081478-86081500 CCAAGGGCAATCCTGTGACAAAG No data
Right 1120567842 14:86081505-86081527 TTGGTACTAAAGGCATTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120567842 Original CRISPR TTGGTACTAAAGGCATTAGA AGG Intergenic
No off target data available for this crispr