ID: 1120573307

View in Genome Browser
Species Human (GRCh38)
Location 14:86148740-86148762
Sequence CATCTCATGCAGAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120573303_1120573307 7 Left 1120573303 14:86148710-86148732 CCATCTCTGGTGAGGCCTTGCTT No data
Right 1120573307 14:86148740-86148762 CATCTCATGCAGAAGGCAGAAGG No data
1120573304_1120573307 -8 Left 1120573304 14:86148725-86148747 CCTTGCTTGCTGTGCCATCTCAT No data
Right 1120573307 14:86148740-86148762 CATCTCATGCAGAAGGCAGAAGG No data
1120573302_1120573307 8 Left 1120573302 14:86148709-86148731 CCCATCTCTGGTGAGGCCTTGCT No data
Right 1120573307 14:86148740-86148762 CATCTCATGCAGAAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120573307 Original CRISPR CATCTCATGCAGAAGGCAGA AGG Intergenic
No off target data available for this crispr