ID: 1120579047

View in Genome Browser
Species Human (GRCh38)
Location 14:86223545-86223567
Sequence GTGTATGAAGATAGAATATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120579047_1120579056 15 Left 1120579047 14:86223545-86223567 CCTAATATTCTATCTTCATACAC No data
Right 1120579056 14:86223583-86223605 GCTGGAGAACATGGACCAGTAGG No data
1120579047_1120579050 -3 Left 1120579047 14:86223545-86223567 CCTAATATTCTATCTTCATACAC No data
Right 1120579050 14:86223565-86223587 CACACCCCAGGGCCTTCTGCTGG No data
1120579047_1120579054 6 Left 1120579047 14:86223545-86223567 CCTAATATTCTATCTTCATACAC No data
Right 1120579054 14:86223574-86223596 GGGCCTTCTGCTGGAGAACATGG No data
1120579047_1120579057 19 Left 1120579047 14:86223545-86223567 CCTAATATTCTATCTTCATACAC No data
Right 1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120579047 Original CRISPR GTGTATGAAGATAGAATATT AGG (reversed) Intergenic
No off target data available for this crispr