ID: 1120579052

View in Genome Browser
Species Human (GRCh38)
Location 14:86223570-86223592
Sequence GTTCTCCAGCAGAAGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120579052_1120579056 -10 Left 1120579052 14:86223570-86223592 CCCAGGGCCTTCTGCTGGAGAAC No data
Right 1120579056 14:86223583-86223605 GCTGGAGAACATGGACCAGTAGG No data
1120579052_1120579057 -6 Left 1120579052 14:86223570-86223592 CCCAGGGCCTTCTGCTGGAGAAC No data
Right 1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG No data
1120579052_1120579060 13 Left 1120579052 14:86223570-86223592 CCCAGGGCCTTCTGCTGGAGAAC No data
Right 1120579060 14:86223606-86223628 CTGGAGTAGAGTTAAGGCTCAGG No data
1120579052_1120579059 7 Left 1120579052 14:86223570-86223592 CCCAGGGCCTTCTGCTGGAGAAC No data
Right 1120579059 14:86223600-86223622 AGTAGGCTGGAGTAGAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120579052 Original CRISPR GTTCTCCAGCAGAAGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr