ID: 1120579053

View in Genome Browser
Species Human (GRCh38)
Location 14:86223571-86223593
Sequence TGTTCTCCAGCAGAAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120579053_1120579059 6 Left 1120579053 14:86223571-86223593 CCAGGGCCTTCTGCTGGAGAACA No data
Right 1120579059 14:86223600-86223622 AGTAGGCTGGAGTAGAGTTAAGG No data
1120579053_1120579057 -7 Left 1120579053 14:86223571-86223593 CCAGGGCCTTCTGCTGGAGAACA No data
Right 1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG No data
1120579053_1120579060 12 Left 1120579053 14:86223571-86223593 CCAGGGCCTTCTGCTGGAGAACA No data
Right 1120579060 14:86223606-86223628 CTGGAGTAGAGTTAAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120579053 Original CRISPR TGTTCTCCAGCAGAAGGCCC TGG (reversed) Intergenic
No off target data available for this crispr