ID: 1120579057

View in Genome Browser
Species Human (GRCh38)
Location 14:86223587-86223609
Sequence GAGAACATGGACCAGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120579053_1120579057 -7 Left 1120579053 14:86223571-86223593 CCAGGGCCTTCTGCTGGAGAACA No data
Right 1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG No data
1120579047_1120579057 19 Left 1120579047 14:86223545-86223567 CCTAATATTCTATCTTCATACAC No data
Right 1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG No data
1120579051_1120579057 -5 Left 1120579051 14:86223569-86223591 CCCCAGGGCCTTCTGCTGGAGAA No data
Right 1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG No data
1120579052_1120579057 -6 Left 1120579052 14:86223570-86223592 CCCAGGGCCTTCTGCTGGAGAAC No data
Right 1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120579057 Original CRISPR GAGAACATGGACCAGTAGGC TGG Intergenic
No off target data available for this crispr