ID: 1120579346

View in Genome Browser
Species Human (GRCh38)
Location 14:86227120-86227142
Sequence CTAGATGTATTTACAACCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120579346_1120579351 16 Left 1120579346 14:86227120-86227142 CCCATGGTTGTAAATACATCTAG No data
Right 1120579351 14:86227159-86227181 TTTTTTTTTTATCTCTTGGCTGG No data
1120579346_1120579350 12 Left 1120579346 14:86227120-86227142 CCCATGGTTGTAAATACATCTAG No data
Right 1120579350 14:86227155-86227177 CCAATTTTTTTTTTATCTCTTGG No data
1120579346_1120579352 17 Left 1120579346 14:86227120-86227142 CCCATGGTTGTAAATACATCTAG No data
Right 1120579352 14:86227160-86227182 TTTTTTTTTATCTCTTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120579346 Original CRISPR CTAGATGTATTTACAACCAT GGG (reversed) Intergenic
No off target data available for this crispr