ID: 1120579347

View in Genome Browser
Species Human (GRCh38)
Location 14:86227121-86227143
Sequence GCTAGATGTATTTACAACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120579347_1120579351 15 Left 1120579347 14:86227121-86227143 CCATGGTTGTAAATACATCTAGC No data
Right 1120579351 14:86227159-86227181 TTTTTTTTTTATCTCTTGGCTGG No data
1120579347_1120579350 11 Left 1120579347 14:86227121-86227143 CCATGGTTGTAAATACATCTAGC No data
Right 1120579350 14:86227155-86227177 CCAATTTTTTTTTTATCTCTTGG No data
1120579347_1120579352 16 Left 1120579347 14:86227121-86227143 CCATGGTTGTAAATACATCTAGC No data
Right 1120579352 14:86227160-86227182 TTTTTTTTTATCTCTTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120579347 Original CRISPR GCTAGATGTATTTACAACCA TGG (reversed) Intergenic
No off target data available for this crispr