ID: 1120579350

View in Genome Browser
Species Human (GRCh38)
Location 14:86227155-86227177
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120579346_1120579350 12 Left 1120579346 14:86227120-86227142 CCCATGGTTGTAAATACATCTAG No data
Right 1120579350 14:86227155-86227177 CCAATTTTTTTTTTATCTCTTGG No data
1120579344_1120579350 17 Left 1120579344 14:86227115-86227137 CCTTCCCCATGGTTGTAAATACA No data
Right 1120579350 14:86227155-86227177 CCAATTTTTTTTTTATCTCTTGG No data
1120579345_1120579350 13 Left 1120579345 14:86227119-86227141 CCCCATGGTTGTAAATACATCTA No data
Right 1120579350 14:86227155-86227177 CCAATTTTTTTTTTATCTCTTGG No data
1120579347_1120579350 11 Left 1120579347 14:86227121-86227143 CCATGGTTGTAAATACATCTAGC No data
Right 1120579350 14:86227155-86227177 CCAATTTTTTTTTTATCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120579350 Original CRISPR CCAATTTTTTTTTTATCTCT TGG Intergenic
No off target data available for this crispr