ID: 1120580194

View in Genome Browser
Species Human (GRCh38)
Location 14:86237973-86237995
Sequence CTGTATAAATGGTTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120580188_1120580194 16 Left 1120580188 14:86237934-86237956 CCAGTGGTAATGAGGTAAAGTTT No data
Right 1120580194 14:86237973-86237995 CTGTATAAATGGTTGGGGGAAGG No data
1120580187_1120580194 17 Left 1120580187 14:86237933-86237955 CCCAGTGGTAATGAGGTAAAGTT No data
Right 1120580194 14:86237973-86237995 CTGTATAAATGGTTGGGGGAAGG No data
1120580186_1120580194 23 Left 1120580186 14:86237927-86237949 CCTCTGCCCAGTGGTAATGAGGT No data
Right 1120580194 14:86237973-86237995 CTGTATAAATGGTTGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120580194 Original CRISPR CTGTATAAATGGTTGGGGGA AGG Intergenic
No off target data available for this crispr