ID: 1120580579

View in Genome Browser
Species Human (GRCh38)
Location 14:86243032-86243054
Sequence TATTTATTATCACCAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120580577_1120580579 30 Left 1120580577 14:86242979-86243001 CCCAGTTGAGTTGAAAACTATTG No data
Right 1120580579 14:86243032-86243054 TATTTATTATCACCAAACACTGG No data
1120580578_1120580579 29 Left 1120580578 14:86242980-86243002 CCAGTTGAGTTGAAAACTATTGT No data
Right 1120580579 14:86243032-86243054 TATTTATTATCACCAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120580579 Original CRISPR TATTTATTATCACCAAACAC TGG Intergenic
No off target data available for this crispr