ID: 1120591697

View in Genome Browser
Species Human (GRCh38)
Location 14:86382083-86382105
Sequence ATACAGTAGCTGAATGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120591697_1120591699 -8 Left 1120591697 14:86382083-86382105 CCATTTCCATTCAGCTACTGTAT No data
Right 1120591699 14:86382098-86382120 TACTGTATCAATGCCAATTCAGG No data
1120591697_1120591701 12 Left 1120591697 14:86382083-86382105 CCATTTCCATTCAGCTACTGTAT No data
Right 1120591701 14:86382118-86382140 AGGAACAGAATCAGAATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120591697 Original CRISPR ATACAGTAGCTGAATGGAAA TGG (reversed) Intergenic
No off target data available for this crispr