ID: 1120594908

View in Genome Browser
Species Human (GRCh38)
Location 14:86421237-86421259
Sequence CTGTGGGTAGAGTAGCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120594903_1120594908 7 Left 1120594903 14:86421207-86421229 CCACAGGACAGCTGTTGTCCATT No data
Right 1120594908 14:86421237-86421259 CTGTGGGTAGAGTAGCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120594908 Original CRISPR CTGTGGGTAGAGTAGCAAAT GGG Intergenic
No off target data available for this crispr