ID: 1120595211

View in Genome Browser
Species Human (GRCh38)
Location 14:86425799-86425821
Sequence ATACTTTTATAAGTGGGAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120595206_1120595211 20 Left 1120595206 14:86425756-86425778 CCAAAGCAATGCACACCACTAAG No data
Right 1120595211 14:86425799-86425821 ATACTTTTATAAGTGGGAAACGG No data
1120595207_1120595211 5 Left 1120595207 14:86425771-86425793 CCACTAAGAATTGAGAATGCTCT No data
Right 1120595211 14:86425799-86425821 ATACTTTTATAAGTGGGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120595211 Original CRISPR ATACTTTTATAAGTGGGAAA CGG Intergenic
No off target data available for this crispr