ID: 1120595527

View in Genome Browser
Species Human (GRCh38)
Location 14:86430568-86430590
Sequence TTGGAAACACATACCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120595527_1120595529 -6 Left 1120595527 14:86430568-86430590 CCCTGCTGGGTATGTGTTTCCAA No data
Right 1120595529 14:86430585-86430607 TTCCAACAAGACTTTTCCCGAGG No data
1120595527_1120595531 -3 Left 1120595527 14:86430568-86430590 CCCTGCTGGGTATGTGTTTCCAA No data
Right 1120595531 14:86430588-86430610 CAACAAGACTTTTCCCGAGGTGG No data
1120595527_1120595534 25 Left 1120595527 14:86430568-86430590 CCCTGCTGGGTATGTGTTTCCAA No data
Right 1120595534 14:86430616-86430638 TCGAATTCACTTGCTAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120595527 Original CRISPR TTGGAAACACATACCCAGCA GGG (reversed) Intergenic
No off target data available for this crispr