ID: 1120599185

View in Genome Browser
Species Human (GRCh38)
Location 14:86480008-86480030
Sequence GGTGGAGTATGATAATTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120599185_1120599189 7 Left 1120599185 14:86480008-86480030 CCCTAAAATTATCATACTCCACC No data
Right 1120599189 14:86480038-86480060 CTTTGTAGCACTAAGTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120599185 Original CRISPR GGTGGAGTATGATAATTTTA GGG (reversed) Intergenic
No off target data available for this crispr