ID: 1120599623

View in Genome Browser
Species Human (GRCh38)
Location 14:86485695-86485717
Sequence CTGGAGAAAGCCTCCTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120599623_1120599634 20 Left 1120599623 14:86485695-86485717 CCACTGAAGGAGGCTTTCTCCAG No data
Right 1120599634 14:86485738-86485760 ATTTTTTTGTGGGTACTCACTGG No data
1120599623_1120599635 21 Left 1120599623 14:86485695-86485717 CCACTGAAGGAGGCTTTCTCCAG No data
Right 1120599635 14:86485739-86485761 TTTTTTTGTGGGTACTCACTGGG No data
1120599623_1120599631 10 Left 1120599623 14:86485695-86485717 CCACTGAAGGAGGCTTTCTCCAG No data
Right 1120599631 14:86485728-86485750 CATTCCCTACATTTTTTTGTGGG No data
1120599623_1120599637 30 Left 1120599623 14:86485695-86485717 CCACTGAAGGAGGCTTTCTCCAG No data
Right 1120599637 14:86485748-86485770 GGGTACTCACTGGGGATTTATGG No data
1120599623_1120599630 9 Left 1120599623 14:86485695-86485717 CCACTGAAGGAGGCTTTCTCCAG No data
Right 1120599630 14:86485727-86485749 CCATTCCCTACATTTTTTTGTGG No data
1120599623_1120599636 22 Left 1120599623 14:86485695-86485717 CCACTGAAGGAGGCTTTCTCCAG No data
Right 1120599636 14:86485740-86485762 TTTTTTGTGGGTACTCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120599623 Original CRISPR CTGGAGAAAGCCTCCTTCAG TGG (reversed) Intergenic
No off target data available for this crispr