ID: 1120602851

View in Genome Browser
Species Human (GRCh38)
Location 14:86533366-86533388
Sequence AAGAAAGAAAAGTGACAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120602851_1120602852 -5 Left 1120602851 14:86533366-86533388 CCTTCTTGTCACTTTTCTTTCTT No data
Right 1120602852 14:86533384-86533406 TTCTTGCAGCATGTACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120602851 Original CRISPR AAGAAAGAAAAGTGACAAGA AGG (reversed) Intergenic
No off target data available for this crispr