ID: 1120603163

View in Genome Browser
Species Human (GRCh38)
Location 14:86537796-86537818
Sequence TAGCTAACCCTATTTTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120603163_1120603172 16 Left 1120603163 14:86537796-86537818 CCAGCAAAAAATAGGGTTAGCTA No data
Right 1120603172 14:86537835-86537857 AATTGGGAGGAAAGTACTCCAGG No data
1120603163_1120603171 3 Left 1120603163 14:86537796-86537818 CCAGCAAAAAATAGGGTTAGCTA No data
Right 1120603171 14:86537822-86537844 AAAGGGGTGAGGCAATTGGGAGG No data
1120603163_1120603169 -1 Left 1120603163 14:86537796-86537818 CCAGCAAAAAATAGGGTTAGCTA No data
Right 1120603169 14:86537818-86537840 AGGTAAAGGGGTGAGGCAATTGG No data
1120603163_1120603168 -8 Left 1120603163 14:86537796-86537818 CCAGCAAAAAATAGGGTTAGCTA No data
Right 1120603168 14:86537811-86537833 GTTAGCTAGGTAAAGGGGTGAGG No data
1120603163_1120603170 0 Left 1120603163 14:86537796-86537818 CCAGCAAAAAATAGGGTTAGCTA No data
Right 1120603170 14:86537819-86537841 GGTAAAGGGGTGAGGCAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120603163 Original CRISPR TAGCTAACCCTATTTTTTGC TGG (reversed) Intergenic
No off target data available for this crispr