ID: 1120604289

View in Genome Browser
Species Human (GRCh38)
Location 14:86553610-86553632
Sequence CTGTGGCATTCACTGTAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120604283_1120604289 11 Left 1120604283 14:86553576-86553598 CCTCCTCCCTGACATGAGTCTAG No data
Right 1120604289 14:86553610-86553632 CTGTGGCATTCACTGTAGTGTGG No data
1120604286_1120604289 4 Left 1120604286 14:86553583-86553605 CCTGACATGAGTCTAGCTTAAAT No data
Right 1120604289 14:86553610-86553632 CTGTGGCATTCACTGTAGTGTGG No data
1120604285_1120604289 5 Left 1120604285 14:86553582-86553604 CCCTGACATGAGTCTAGCTTAAA No data
Right 1120604289 14:86553610-86553632 CTGTGGCATTCACTGTAGTGTGG No data
1120604284_1120604289 8 Left 1120604284 14:86553579-86553601 CCTCCCTGACATGAGTCTAGCTT No data
Right 1120604289 14:86553610-86553632 CTGTGGCATTCACTGTAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120604289 Original CRISPR CTGTGGCATTCACTGTAGTG TGG Intergenic
No off target data available for this crispr