ID: 1120612357

View in Genome Browser
Species Human (GRCh38)
Location 14:86657939-86657961
Sequence GGTGAACTCCACCATGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120612357_1120612364 9 Left 1120612357 14:86657939-86657961 CCATTCCCATGGTGGAGTTCACC No data
Right 1120612364 14:86657971-86657993 ATGACCTCTTGACCTCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120612357 Original CRISPR GGTGAACTCCACCATGGGAA TGG (reversed) Intergenic
No off target data available for this crispr