ID: 1120614824

View in Genome Browser
Species Human (GRCh38)
Location 14:86690306-86690328
Sequence CTGTCTATGAATCAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120614821_1120614824 7 Left 1120614821 14:86690276-86690298 CCTCTATGTGAGGACACAGTGAG 0: 9
1: 130
2: 366
3: 953
4: 1526
Right 1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG No data
1120614818_1120614824 21 Left 1120614818 14:86690262-86690284 CCCTAGCTGTTCTTCCTCTATGT No data
Right 1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG No data
1120614819_1120614824 20 Left 1120614819 14:86690263-86690285 CCTAGCTGTTCTTCCTCTATGTG No data
Right 1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120614824 Original CRISPR CTGTCTATGAATCAGGAAGA AGG Intergenic
No off target data available for this crispr