ID: 1120624447

View in Genome Browser
Species Human (GRCh38)
Location 14:86807309-86807331
Sequence CCTCACATGTGGAAGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120624439_1120624447 16 Left 1120624439 14:86807270-86807292 CCATGTTGCTGAACTTTTTAGGA No data
Right 1120624447 14:86807309-86807331 CCTCACATGTGGAAGGCAGAGGG No data
1120624437_1120624447 27 Left 1120624437 14:86807259-86807281 CCAAGATGGTGCCATGTTGCTGA No data
Right 1120624447 14:86807309-86807331 CCTCACATGTGGAAGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120624447 Original CRISPR CCTCACATGTGGAAGGCAGA GGG Intergenic
No off target data available for this crispr