ID: 1120625936

View in Genome Browser
Species Human (GRCh38)
Location 14:86826556-86826578
Sequence CAGAAGAAAGAGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120625931_1120625936 19 Left 1120625931 14:86826514-86826536 CCAAAAGAGGAATTGGTTTATTT No data
Right 1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120625936 Original CRISPR CAGAAGAAAGAGAAAGAGGA GGG Intergenic
No off target data available for this crispr