ID: 1120637267

View in Genome Browser
Species Human (GRCh38)
Location 14:86967648-86967670
Sequence TACTACTGTATTTCACATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120637267_1120637271 11 Left 1120637267 14:86967648-86967670 CCCTAATGTGAAATACAGTAGTA No data
Right 1120637271 14:86967682-86967704 CATATTAGAGAAAGACATTATGG No data
1120637267_1120637272 17 Left 1120637267 14:86967648-86967670 CCCTAATGTGAAATACAGTAGTA No data
Right 1120637272 14:86967688-86967710 AGAGAAAGACATTATGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120637267 Original CRISPR TACTACTGTATTTCACATTA GGG (reversed) Intergenic
No off target data available for this crispr