ID: 1120640033

View in Genome Browser
Species Human (GRCh38)
Location 14:86999601-86999623
Sequence CCCATCACACAGGTGCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120640033 Original CRISPR CCCATCACACAGGTGCTCCA AGG Intergenic