ID: 1120641519

View in Genome Browser
Species Human (GRCh38)
Location 14:87019167-87019189
Sequence CAGGATATACAGAGCAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120641511_1120641519 23 Left 1120641511 14:87019121-87019143 CCCTGAATGGGGAAATGCAGGGC No data
Right 1120641519 14:87019167-87019189 CAGGATATACAGAGCAAAGAGGG No data
1120641509_1120641519 24 Left 1120641509 14:87019120-87019142 CCCCTGAATGGGGAAATGCAGGG No data
Right 1120641519 14:87019167-87019189 CAGGATATACAGAGCAAAGAGGG No data
1120641512_1120641519 22 Left 1120641512 14:87019122-87019144 CCTGAATGGGGAAATGCAGGGCT No data
Right 1120641519 14:87019167-87019189 CAGGATATACAGAGCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120641519 Original CRISPR CAGGATATACAGAGCAAAGA GGG Intergenic
No off target data available for this crispr