ID: 1120645939

View in Genome Browser
Species Human (GRCh38)
Location 14:87074086-87074108
Sequence TCTTATCTATGGAACGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120645939_1120645941 -10 Left 1120645939 14:87074086-87074108 CCTTTCACGTTCCATAGATAAGA No data
Right 1120645941 14:87074099-87074121 ATAGATAAGAACTCAGCACTTGG No data
1120645939_1120645943 12 Left 1120645939 14:87074086-87074108 CCTTTCACGTTCCATAGATAAGA No data
Right 1120645943 14:87074121-87074143 GACTCACTTCAATGCAAGGCAGG No data
1120645939_1120645942 8 Left 1120645939 14:87074086-87074108 CCTTTCACGTTCCATAGATAAGA No data
Right 1120645942 14:87074117-87074139 CTTGGACTCACTTCAATGCAAGG No data
1120645939_1120645944 16 Left 1120645939 14:87074086-87074108 CCTTTCACGTTCCATAGATAAGA No data
Right 1120645944 14:87074125-87074147 CACTTCAATGCAAGGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120645939 Original CRISPR TCTTATCTATGGAACGTGAA AGG (reversed) Intergenic
No off target data available for this crispr