ID: 1120645941

View in Genome Browser
Species Human (GRCh38)
Location 14:87074099-87074121
Sequence ATAGATAAGAACTCAGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120645937_1120645941 12 Left 1120645937 14:87074064-87074086 CCAGGAATGATACTGATTATGCC No data
Right 1120645941 14:87074099-87074121 ATAGATAAGAACTCAGCACTTGG No data
1120645936_1120645941 13 Left 1120645936 14:87074063-87074085 CCCAGGAATGATACTGATTATGC No data
Right 1120645941 14:87074099-87074121 ATAGATAAGAACTCAGCACTTGG No data
1120645939_1120645941 -10 Left 1120645939 14:87074086-87074108 CCTTTCACGTTCCATAGATAAGA No data
Right 1120645941 14:87074099-87074121 ATAGATAAGAACTCAGCACTTGG No data
1120645938_1120645941 -9 Left 1120645938 14:87074085-87074107 CCCTTTCACGTTCCATAGATAAG No data
Right 1120645941 14:87074099-87074121 ATAGATAAGAACTCAGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120645941 Original CRISPR ATAGATAAGAACTCAGCACT TGG Intergenic
No off target data available for this crispr