ID: 1120645943

View in Genome Browser
Species Human (GRCh38)
Location 14:87074121-87074143
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120645940_1120645943 1 Left 1120645940 14:87074097-87074119 CCATAGATAAGAACTCAGCACTT No data
Right 1120645943 14:87074121-87074143 GACTCACTTCAATGCAAGGCAGG No data
1120645938_1120645943 13 Left 1120645938 14:87074085-87074107 CCCTTTCACGTTCCATAGATAAG No data
Right 1120645943 14:87074121-87074143 GACTCACTTCAATGCAAGGCAGG No data
1120645939_1120645943 12 Left 1120645939 14:87074086-87074108 CCTTTCACGTTCCATAGATAAGA No data
Right 1120645943 14:87074121-87074143 GACTCACTTCAATGCAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120645943 Original CRISPR GACTCACTTCAATGCAAGGC AGG Intergenic
No off target data available for this crispr