ID: 1120647315

View in Genome Browser
Species Human (GRCh38)
Location 14:87089460-87089482
Sequence GAGAATAAAAAGATGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120647315_1120647317 9 Left 1120647315 14:87089460-87089482 CCAGAATCCATCTTTTTATTCTC No data
Right 1120647317 14:87089492-87089514 TAGATTAGTCATATAAATGTTGG No data
1120647315_1120647318 10 Left 1120647315 14:87089460-87089482 CCAGAATCCATCTTTTTATTCTC No data
Right 1120647318 14:87089493-87089515 AGATTAGTCATATAAATGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120647315 Original CRISPR GAGAATAAAAAGATGGATTC TGG (reversed) Intergenic
No off target data available for this crispr