ID: 1120649552

View in Genome Browser
Species Human (GRCh38)
Location 14:87115384-87115406
Sequence TAATTCTGGCTTGTAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120649552_1120649553 -10 Left 1120649552 14:87115384-87115406 CCAGCAGCTACAAGCCAGAATTA No data
Right 1120649553 14:87115397-87115419 GCCAGAATTAAGCCTGATAATGG No data
1120649552_1120649561 27 Left 1120649552 14:87115384-87115406 CCAGCAGCTACAAGCCAGAATTA No data
Right 1120649561 14:87115434-87115456 GCTTTCCCTGTTTTGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120649552 Original CRISPR TAATTCTGGCTTGTAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr