ID: 1120649792

View in Genome Browser
Species Human (GRCh38)
Location 14:87118438-87118460
Sequence ATACCACTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120649792_1120649797 19 Left 1120649792 14:87118438-87118460 CCTTCACTCTTCTAGAGTGGTAT No data
Right 1120649797 14:87118480-87118502 TCCATGGTTTGGAGTAAATGAGG No data
1120649792_1120649794 3 Left 1120649792 14:87118438-87118460 CCTTCACTCTTCTAGAGTGGTAT No data
Right 1120649794 14:87118464-87118486 TTGTTAGGTCCTTTTTTCCATGG No data
1120649792_1120649795 8 Left 1120649792 14:87118438-87118460 CCTTCACTCTTCTAGAGTGGTAT No data
Right 1120649795 14:87118469-87118491 AGGTCCTTTTTTCCATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120649792 Original CRISPR ATACCACTCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr