ID: 1120649974

View in Genome Browser
Species Human (GRCh38)
Location 14:87120230-87120252
Sequence GAGTAGGCTCAGGAGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120649969_1120649974 30 Left 1120649969 14:87120177-87120199 CCAATTCATGAATCATTCTTTGC No data
Right 1120649974 14:87120230-87120252 GAGTAGGCTCAGGAGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120649974 Original CRISPR GAGTAGGCTCAGGAGTGGAG AGG Intergenic
No off target data available for this crispr