ID: 1120651086

View in Genome Browser
Species Human (GRCh38)
Location 14:87133606-87133628
Sequence CATGCCCAGGACTCTGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120651080_1120651086 20 Left 1120651080 14:87133563-87133585 CCACCTGGGCTAGGGGAAGTGAC No data
Right 1120651086 14:87133606-87133628 CATGCCCAGGACTCTGGCGGAGG No data
1120651081_1120651086 17 Left 1120651081 14:87133566-87133588 CCTGGGCTAGGGGAAGTGACTCA No data
Right 1120651086 14:87133606-87133628 CATGCCCAGGACTCTGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120651086 Original CRISPR CATGCCCAGGACTCTGGCGG AGG Intergenic
No off target data available for this crispr