ID: 1120651468

View in Genome Browser
Species Human (GRCh38)
Location 14:87138893-87138915
Sequence ACAGAAAATAATTTTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120651468_1120651470 2 Left 1120651468 14:87138893-87138915 CCTGCTTTAAAATTATTTTCTGT No data
Right 1120651470 14:87138918-87138940 ATTCCAACTTTTAGTTATTTGGG No data
1120651468_1120651472 22 Left 1120651468 14:87138893-87138915 CCTGCTTTAAAATTATTTTCTGT No data
Right 1120651472 14:87138938-87138960 GGGTTTCTATTTCCATTGACTGG No data
1120651468_1120651469 1 Left 1120651468 14:87138893-87138915 CCTGCTTTAAAATTATTTTCTGT No data
Right 1120651469 14:87138917-87138939 AATTCCAACTTTTAGTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120651468 Original CRISPR ACAGAAAATAATTTTAAAGC AGG (reversed) Intergenic
No off target data available for this crispr