ID: 1120654240

View in Genome Browser
Species Human (GRCh38)
Location 14:87169935-87169957
Sequence CAAAATGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120654240_1120654243 4 Left 1120654240 14:87169935-87169957 CCCATATCACTATCAGCATTTTG No data
Right 1120654243 14:87169962-87169984 AAACAATTCAACAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120654240 Original CRISPR CAAAATGCTGATAGTGATAT GGG (reversed) Intergenic