ID: 1120655859

View in Genome Browser
Species Human (GRCh38)
Location 14:87189155-87189177
Sequence CTGTAGGTCAAGGTTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120655859_1120655865 12 Left 1120655859 14:87189155-87189177 CCATCCTCAACCTTGACCTACAG No data
Right 1120655865 14:87189190-87189212 GCTTATTATTCTGCACACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120655859 Original CRISPR CTGTAGGTCAAGGTTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr