ID: 1120663715

View in Genome Browser
Species Human (GRCh38)
Location 14:87280569-87280591
Sequence AGAGACTGGTTTTGTGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120663715_1120663719 -6 Left 1120663715 14:87280569-87280591 CCTTTTCCACAAAACCAGTCTCT No data
Right 1120663719 14:87280586-87280608 GTCTCTGGTTCCAAAAAGTCTGG No data
1120663715_1120663720 -5 Left 1120663715 14:87280569-87280591 CCTTTTCCACAAAACCAGTCTCT No data
Right 1120663720 14:87280587-87280609 TCTCTGGTTCCAAAAAGTCTGGG No data
1120663715_1120663721 -4 Left 1120663715 14:87280569-87280591 CCTTTTCCACAAAACCAGTCTCT No data
Right 1120663721 14:87280588-87280610 CTCTGGTTCCAAAAAGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120663715 Original CRISPR AGAGACTGGTTTTGTGGAAA AGG (reversed) Intergenic
No off target data available for this crispr