ID: 1120663721

View in Genome Browser
Species Human (GRCh38)
Location 14:87280588-87280610
Sequence CTCTGGTTCCAAAAAGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120663717_1120663721 -10 Left 1120663717 14:87280575-87280597 CCACAAAACCAGTCTCTGGTTCC No data
Right 1120663721 14:87280588-87280610 CTCTGGTTCCAAAAAGTCTGGGG No data
1120663713_1120663721 13 Left 1120663713 14:87280552-87280574 CCTGTCCATGGAAAAATCCTTTT No data
Right 1120663721 14:87280588-87280610 CTCTGGTTCCAAAAAGTCTGGGG No data
1120663707_1120663721 21 Left 1120663707 14:87280544-87280566 CCCCCACCCCTGTCCATGGAAAA No data
Right 1120663721 14:87280588-87280610 CTCTGGTTCCAAAAAGTCTGGGG No data
1120663712_1120663721 14 Left 1120663712 14:87280551-87280573 CCCTGTCCATGGAAAAATCCTTT No data
Right 1120663721 14:87280588-87280610 CTCTGGTTCCAAAAAGTCTGGGG No data
1120663715_1120663721 -4 Left 1120663715 14:87280569-87280591 CCTTTTCCACAAAACCAGTCTCT No data
Right 1120663721 14:87280588-87280610 CTCTGGTTCCAAAAAGTCTGGGG No data
1120663710_1120663721 18 Left 1120663710 14:87280547-87280569 CCACCCCTGTCCATGGAAAAATC No data
Right 1120663721 14:87280588-87280610 CTCTGGTTCCAAAAAGTCTGGGG No data
1120663714_1120663721 8 Left 1120663714 14:87280557-87280579 CCATGGAAAAATCCTTTTCCACA No data
Right 1120663721 14:87280588-87280610 CTCTGGTTCCAAAAAGTCTGGGG No data
1120663708_1120663721 20 Left 1120663708 14:87280545-87280567 CCCCACCCCTGTCCATGGAAAAA 0: 7
1: 47
2: 159
3: 378
4: 892
Right 1120663721 14:87280588-87280610 CTCTGGTTCCAAAAAGTCTGGGG No data
1120663711_1120663721 15 Left 1120663711 14:87280550-87280572 CCCCTGTCCATGGAAAAATCCTT No data
Right 1120663721 14:87280588-87280610 CTCTGGTTCCAAAAAGTCTGGGG No data
1120663709_1120663721 19 Left 1120663709 14:87280546-87280568 CCCACCCCTGTCCATGGAAAAAT 0: 9
1: 62
2: 163
3: 416
4: 876
Right 1120663721 14:87280588-87280610 CTCTGGTTCCAAAAAGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120663721 Original CRISPR CTCTGGTTCCAAAAAGTCTG GGG Intergenic
No off target data available for this crispr