ID: 1120664979

View in Genome Browser
Species Human (GRCh38)
Location 14:87295057-87295079
Sequence GAGAGCAAACTGATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120664974_1120664979 15 Left 1120664974 14:87295019-87295041 CCCAAAAGATGAGGGGTGTTTAT No data
Right 1120664979 14:87295057-87295079 GAGAGCAAACTGATTGAGGAAGG No data
1120664975_1120664979 14 Left 1120664975 14:87295020-87295042 CCAAAAGATGAGGGGTGTTTATC No data
Right 1120664979 14:87295057-87295079 GAGAGCAAACTGATTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120664979 Original CRISPR GAGAGCAAACTGATTGAGGA AGG Intergenic
No off target data available for this crispr