ID: 1120667596

View in Genome Browser
Species Human (GRCh38)
Location 14:87325281-87325303
Sequence ACATTTGGTTTTTGTAATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120667596_1120667601 29 Left 1120667596 14:87325281-87325303 CCCCTATTACAAAAACCAAATGT No data
Right 1120667601 14:87325333-87325355 TTATATATGAATACCAAGGATGG No data
1120667596_1120667600 25 Left 1120667596 14:87325281-87325303 CCCCTATTACAAAAACCAAATGT No data
Right 1120667600 14:87325329-87325351 ATATTTATATATGAATACCAAGG No data
1120667596_1120667602 30 Left 1120667596 14:87325281-87325303 CCCCTATTACAAAAACCAAATGT No data
Right 1120667602 14:87325334-87325356 TATATATGAATACCAAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120667596 Original CRISPR ACATTTGGTTTTTGTAATAG GGG (reversed) Intergenic
No off target data available for this crispr