ID: 1120667600

View in Genome Browser
Species Human (GRCh38)
Location 14:87325329-87325351
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120667598_1120667600 23 Left 1120667598 14:87325283-87325305 CCTATTACAAAAACCAAATGTTA No data
Right 1120667600 14:87325329-87325351 ATATTTATATATGAATACCAAGG No data
1120667599_1120667600 10 Left 1120667599 14:87325296-87325318 CCAAATGTTAAATATTTTTAATA No data
Right 1120667600 14:87325329-87325351 ATATTTATATATGAATACCAAGG No data
1120667596_1120667600 25 Left 1120667596 14:87325281-87325303 CCCCTATTACAAAAACCAAATGT No data
Right 1120667600 14:87325329-87325351 ATATTTATATATGAATACCAAGG No data
1120667597_1120667600 24 Left 1120667597 14:87325282-87325304 CCCTATTACAAAAACCAAATGTT No data
Right 1120667600 14:87325329-87325351 ATATTTATATATGAATACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120667600 Original CRISPR ATATTTATATATGAATACCA AGG Intergenic
No off target data available for this crispr