ID: 1120667602 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:87325334-87325356 |
Sequence | TATATATGAATACCAAGGAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1120667597_1120667602 | 29 | Left | 1120667597 | 14:87325282-87325304 | CCCTATTACAAAAACCAAATGTT | No data | ||
Right | 1120667602 | 14:87325334-87325356 | TATATATGAATACCAAGGATGGG | No data | ||||
1120667599_1120667602 | 15 | Left | 1120667599 | 14:87325296-87325318 | CCAAATGTTAAATATTTTTAATA | No data | ||
Right | 1120667602 | 14:87325334-87325356 | TATATATGAATACCAAGGATGGG | No data | ||||
1120667596_1120667602 | 30 | Left | 1120667596 | 14:87325281-87325303 | CCCCTATTACAAAAACCAAATGT | No data | ||
Right | 1120667602 | 14:87325334-87325356 | TATATATGAATACCAAGGATGGG | No data | ||||
1120667598_1120667602 | 28 | Left | 1120667598 | 14:87325283-87325305 | CCTATTACAAAAACCAAATGTTA | No data | ||
Right | 1120667602 | 14:87325334-87325356 | TATATATGAATACCAAGGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1120667602 | Original CRISPR | TATATATGAATACCAAGGAT GGG | Intergenic | ||
No off target data available for this crispr |