ID: 1120686035

View in Genome Browser
Species Human (GRCh38)
Location 14:87538909-87538931
Sequence AGTTCTGTAGTGAAGGTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120686030_1120686035 11 Left 1120686030 14:87538875-87538897 CCATCTAAAGACCGGCTTATTGG No data
Right 1120686035 14:87538909-87538931 AGTTCTGTAGTGAAGGTATATGG No data
1120686032_1120686035 0 Left 1120686032 14:87538886-87538908 CCGGCTTATTGGATATCCTTTAA No data
Right 1120686035 14:87538909-87538931 AGTTCTGTAGTGAAGGTATATGG No data
1120686029_1120686035 17 Left 1120686029 14:87538869-87538891 CCAATTCCATCTAAAGACCGGCT No data
Right 1120686035 14:87538909-87538931 AGTTCTGTAGTGAAGGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120686035 Original CRISPR AGTTCTGTAGTGAAGGTATA TGG Intergenic
No off target data available for this crispr