ID: 1120686549

View in Genome Browser
Species Human (GRCh38)
Location 14:87544380-87544402
Sequence TTATAGCCATGGCAATGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120686543_1120686549 24 Left 1120686543 14:87544333-87544355 CCCGGTTCTTTCTATAAGGAATG No data
Right 1120686549 14:87544380-87544402 TTATAGCCATGGCAATGGTGTGG No data
1120686544_1120686549 23 Left 1120686544 14:87544334-87544356 CCGGTTCTTTCTATAAGGAATGA No data
Right 1120686549 14:87544380-87544402 TTATAGCCATGGCAATGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120686549 Original CRISPR TTATAGCCATGGCAATGGTG TGG Intergenic
No off target data available for this crispr