ID: 1120687430

View in Genome Browser
Species Human (GRCh38)
Location 14:87554407-87554429
Sequence CTGCTTTGTAATAGCCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120687430_1120687436 19 Left 1120687430 14:87554407-87554429 CCAGCGTGGCTATTACAAAGCAG No data
Right 1120687436 14:87554449-87554471 GCTGGCTTGTTTTGAGTCTTCGG No data
1120687430_1120687435 1 Left 1120687430 14:87554407-87554429 CCAGCGTGGCTATTACAAAGCAG No data
Right 1120687435 14:87554431-87554453 TGGAAGAAGGTAGGATAAGCTGG No data
1120687430_1120687434 -8 Left 1120687430 14:87554407-87554429 CCAGCGTGGCTATTACAAAGCAG No data
Right 1120687434 14:87554422-87554444 CAAAGCAGGTGGAAGAAGGTAGG 0: 24
1: 58
2: 96
3: 146
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120687430 Original CRISPR CTGCTTTGTAATAGCCACGC TGG (reversed) Intergenic
No off target data available for this crispr